95
|
Addgene inc
lentiviral plasmid vector plvthm Lentiviral Plasmid Vector Plvthm, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pLVTHM+(Plasmid+%2312247)/pmc03092528-71-15-19 Average 95 stars, based on 1 article reviews
lentiviral plasmid vector plvthm - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
93
|
Addgene inc
lentiviral plvth vectors Lentiviral Plvth Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pLVTH+(Plasmid+%2312262)/pmc02435686-130-36-39 Average 93 stars, based on 1 article reviews
lentiviral plvth vectors - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
Addgene inc
shtspan5 gcaaattcgtgtcgtataaca  Shtspan5 Gcaaattcgtgtcgtataaca, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pSicoR+(Plasmid+%2311579)/pmc06899445-425-38-48 Average 93 stars, based on 1 article reviews
shtspan5 gcaaattcgtgtcgtataaca - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
96
|
New England Biolabs
clai Clai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/ClaI/custom%40r0197%4023341882 Average 96 stars, based on 1 article reviews
clai - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
t4 dna ligase T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/T4+DNA+Ligase/custom%40m0202%4023341882 Average 99 stars, based on 1 article reviews
t4 dna ligase - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
96
|
Addgene inc
small hairpin rna shrna Small Hairpin Rna Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/shRNA+(Plasmid+%2355783)/pmc03092528-71-0-19 Average 96 stars, based on 1 article reviews
small hairpin rna shrna - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
98
|
Addgene inc
packaging plasmid pspax2 Packaging Plasmid Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/psPAX2+(Plasmid+%2312260)/pmc06258834-202-15-23 Average 98 stars, based on 1 article reviews
packaging plasmid pspax2 - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
96
|
Addgene inc
1999 addgene plasmid 1999 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/gRNA_Cloning+Vector+(Plasmid+%2341824)/pm30917318-221-102-118 Average 96 stars, based on 1 article reviews
1999 addgene plasmid - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
99
|
Bio-Rad
algorithms image lab bio rad Algorithms Image Lab Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/Image+Lab+Software/pm30661960-195-211-214 Average 99 stars, based on 1 article reviews
algorithms image lab bio rad - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pbabe zeo largetgenomic Pbabe Zeo Largetgenomic, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pBABE-neo-hTERT+(Plasmid+%231774)/pm30661960-195-160-177 Average 93 stars, based on 1 article reviews
pbabe zeo largetgenomic - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
98
|
Addgene inc
pbabe neo htert Pbabe Neo Htert, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pMD2%2EG+(Plasmid+%2312259)/pm30661960-195-152-177 Average 98 stars, based on 1 article reviews
pbabe neo htert - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pbabe puro ras v12 Pbabe Puro Ras V12, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/recombinant+plvthm+vectors/pBabe-puro+Ras+V12+(Plasmid+%231768)/pm30661960-195-169-177 Average 93 stars, based on 1 article reviews
pbabe puro ras v12 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports
Article Title: TSPAN5 Enriched Microdomains Provide a Platform for Dendritic Spine Maturation through Neuroligin-1 Clustering
doi: 10.1016/j.celrep.2019.09.051
Figure Lengend Snippet:
Article Snippet: pLVTHM-ShTSPAN5 was obtained by ligation of previously described ShRNA sequence specific for rat TSPAN5 (CAGGACAATTTAACCATTGTG) ( ) into pLVTHM vector, at MluI/ClaI sites. pLVTHM-Scrambled was obtained by inserting a sequence derived by random mixing of the bases from
Techniques: Transduction, Recombinant, Modification, Software, Imaging